A pig’s heart beating in a human’s body? Sounds like a story out of greek mythology — but this kind of transplantation is exactly what scientists were able to achieve at the beginning of this year. With their procedure, they prolonged the life of the patient by two months.

However, it would not be possible to transplant an organ from an ordinary house pig running around on the farm next door into a human’s chest, as this would lead to a certain death of the patient. Even before its birth, the pig was heavily mutated to enable a xenotransplantation, meaning a transplantation between different species. The production of pig-specific proteins produced by cells of the heart was switched off. Moreover, additional products important for the heart functioning correctly in the person’s body were introduced. How was this done?

What is CRISPR-Cas9?

In our laboratory at university, even undergrad students started working with CRISPR-Cas9 as the professors admired the simplicity of the method — and they were right, it is actually quite easy to set up a CRISPR-Cas9 system. However, you might not have studied Molecular Biology and still want to get a grip on the technology. Well, sometimes I am not sure whether I got the grip on CRISPR-Cas9 myself. To solve those problems, I will try to explain how a CRISPR-Cas9 system functions and how to mutate any organism that comes to your mind. Just please don’t use this knowledge to kill all of us.

There is the possibility that you never heard about CRISPR-Cas9 and that is completely okay. When I mentioned it to friends in the past, not less than five people asked me whether I was talking about a granola bar. CRISPR is the abbreviation for ‘Clustered Regularly Interspaced Short Palindromic Repeats’ (even I have to look it up every time) and Cas9 is a ‘CRISPR associated’ protein (which just means it is important for the CRISPR system). The term ‘CRISPR’ describes the components of the system in a cell: it consists of short repeats of DNA that are clustered, regularly, interspaced and palindromic. If you are confused at this point: I’m sorry and I will try to untangle all of this. What makes CRISPR-Cas9 so cool is that you can artificially create these short repeats of DNA and use them for genetic manipulation of nearly all organisms on this planet, be it animals, plants or bacteria.

The origin of CRISPR-Cas9

To figure out how CRISPR-Cas9 functions, it is quite essential to understand its origin. Therefore it is necessary to talk about a topic I would much rather prefer not talking about anymore. You probably heard about them once or twice in the last years: viruses. They can be responsible for people feeling miserable for weeks and nobody is particularly pleased to have them in their system. By nobody, I also mean bacteria. Yes, even bacteria can get infected by viruses and because they are tiny and fragile, chances are high that an infection with a virus leads to their death. Millions of years of evolution, however, let to a bacterial immune system — CRISPR-Cas9. To understand the epic fight of bacteria against viruses, you first need to understand how viruses attack cells.

A virus attack

Viruses are pirates and shapeshifters. It is hard to get what they really are, but scientists agree that they are neither animal nor bacteria. The reason for that is that they cannot reproduce on their own — they need an assistant who performs the reproduction for them. Namely, a host. And here is where the shapeshifting begins. To enter the cells of a host, they need a safe shell, a kind of submarine. This is called a capsule. Surrounded by their capsule, a few viruses hijack the cell like pirates and convince it to produce more and more new viruses. Eventually, a whole virus army can blow up the cell and leave in search for a new host (or world domination). How does convincing the host to produce more viruses look like? Well, the virus shape shifts itself into a memo, but it is a memo in ‘cell language’ — DNA (or RNA, there are different kinds of viruses, but let’s ignore this for now). The memo says ‘Dear cell, could you please produce a bit more of protein x? Would be great! Love, y̶o̶u̶r̶ ̶v̶i̶r̶u̶s̶ um, an important biochemical mechanism in your cell’. By pretending the memo is coming from a part of the cell, it is easy to convince the cell to produce all proteins necessary for the virus army. And with that, the cell is doomed.

The defense system

Over time, some bacteria developed a defense against viruses — the CRISPR-Cas9 system. It evolved as a weapon by destroying the camouflaged memos the virus is sending to the cell — the virus DNA. However, there is a little problem: The cell cannot just destroy any DNA it finds, because it needs quite a lot of DNA itself to function correctly.

DNA – this is the code that carries all the information to create a living organism. Among other components, it consists of four different bases: Adenine, cytosine, guanine and thymine (short A, C, G and T). If you combine these bases in a particular order, you can encode close to anything. The gene named MC1R that defines your hair color starts like this: ATTCTTCCCAGGACCTCAGC…

What can you do to identify the DNA of a virus? First, not that much. You do not know the identity (or DNA) of the virus, as you never encountered them. If you are somehow still alive after the virus attack, however, you can do one thing — remember. Exactly in the same fashion the police does it, the cell creates a library with data about the viruses. There is space left on the bacterial DNA just for this case: To integrate parts of the virus DNA and keep these parts for later reference (find a paper on how they discovered this left space here). This space is quite special, as it consists of palindromes.

Special bookshelves

‘Dammit, I’m mad’ or ‘Mom’ are palindromes. When you start reading from the beginning of the word, you get the same word as when you start reading from the last letter. A palindrome on the DNA could look like this: ‘AATCTGGTCTAA’. DNA palindromes cannot be translated into functional proteins, but they are far from useless.

Palindromes can function as bookshelves. In between them, the information about the virus pirates can be stored (it looks like this: ‘AATCTGInformationAboutTheVirusGTCTAA’). And if a virus dares to enter the cell a second time, the cell is ready to defend itself. So, what happens when the virus tries its second attack? As normally, it encounters different proteins in the cell. However, due to bad experiences in the past, these ‘doorkeepers’ are skeptical. Just to be sure, the library is checked for the DNA of the virus — and the DNA is found. Now, two things happen.

1. The cell locates the virus DNA.

2. A weapon is created to destroy it.

Read and react

For the first step, information stored in the library is necessary. This information can be transcribed from DNA into RNA.

RNA — it is built up similar to DNA (remember, ATCG…) and can act as a messenger. When a protein is needed in the cell, the information from the DNA is required. However, the DNA is a valuable library and without it the cell cannot survive, therefore it is stored in a secure place in the cell (the nucleus). To create a protein elsewhere, DNA is transcribed into RNA and this RNA can now be used as a building instruction about how to create the protein. If anything happens to the RNA and it gets destroyed, it doesn’t matter — the original copy of the information is still securely stored on the DNA.

Now, a piece of RNA contains information about the virus. It is called crRNA (CRISPR RNA) and can be used to identify the virus. You can think of it as a photo of a robber pinned to every tree in the forest. A tracrRNA (trans-activating crRNA) is necessary to activate the crRNA — so that it can start moving through the cell and look for the virus. But something is still missing: The weapon to fight the virus. This weapon is an endonuclease.

What the heck is an endonuclease? You can think of it as scissors that cut DNA or RNA. They are needed by the cell to get rid of garbage — stuff that flies around useless and gets into the way of important biochemical pathways. This could be for example RNA that was not translated into a protein because the protein was not needed anymore. Or it could be virus DNA.

This endonuclease is called Cas9 (remember, the CRSIPR associated protein from the beginning). What happens now is pretty simple. The crRNA guides the weapon, Cas9, to the virus DNA. Then Cas9 cuts it into small pieces — so no proteins necessary for the virus army can be produced — and the cell is safe (more on Cas9 and its discovery can be found here).

A summary of the CRISPR-Cas9 system:

1. A cell gets attacked by a virus and survives the attack

2. Virus DNA is stored in a library consisting of palindromes

3. The virus returns: Virus DNA is transcribed into crRNA

4. crRNA guides Cas9, the weapon, to the virus DNA

5. Virus DNA is cut — virus is gone — everybody (except of the virus) is happy

Now I have a task for you: Think of one potential problem this system might have. It has to do with the virus DNA…

PAM

Did you discover something? Cas9 cuts virus DNA. And the exact same DNA is stored in the library to remember the appearance of the virus DNA. How does the cell prevent Cas9 from targeting and destroying the virus DNA sequence that is stored on its own DNA? The solution is the PAM sequence. Cas9 can only cut after a specific sequence of DNA. This sequence in DNA code is ‘NGG’ (if you wonder now whether you missed out on a building block called N on the DNA: N can be either A, G, T or C). This so-called PAM sequence (‘Protospacer adjacent motif’ if we do not want to miss out on that meaning) only exists on the virus DNA of the actual virus, but not on the virus DNA in the DNA library of the cell. No PAM sequence means no cutting of the DNA.

I think now you know everything you need to know about how CRISPR-Cas9 works — great! It actually isn’t that difficult, is it? (If you know already a lot about CRISPR-Cas9 and think ‘But there is so much more to it!’ then this might not be the right article for you, sorry!).

How does it work in the lab?

What comes next is so great that it was awarded with a Nobel prize (see the two papers here and here). And it is really damn exciting. You can take the CRISPR-Cas9 system from bacteria and apply it to any other organism that comes to your mind. Cas9 cannot only cut virus DNA, but also any other DNA on this earth that has a PAM sequence. It only needs the RNAs, crRNA and tracrRNA to guide it to the respective DNA sequence. The DNA that is cut does not function anymore — the protein that was encoded is not produced anymore — whatever the protein was necessary for does not happen anymore.

Shopping for DNA

Let’s come back to the beginning of the article and the pig’s heart. The basics of CRISPR-Cas9 are hopefully understandable now, but we are still not even one step closer to a mutated heart. Guide RNAs are what brings everything together. You know about crRNAs already, the RNAs that guide the Cas9 scissors to their destination. But it is also possible to design these RNAs artificially. Those artificial RNAs are called guide RNAs (or short: gRNAs), as they fulfill the exact same function — they guide Cas9 towards a destination. Imagine now that you want to mutate the pig’s heart. Because you have intelligent fellow biologists, you already know that a part of the DNA in the cells of the pig’s heart is responsible for encoding protein xy. Protein xy could lead to the heart being rejected by the human patient. So you would like to get rid of protein xy. The first thing you would do in the lab now is going to your computer and designing a guide RNA.

5 easy steps to order the right guide RNA:

1. Go to a website as for example http://crispor.tefor.net/

2. Enter the DNA sequence of the DNA you want to get rid of (in this case the DNA sequence encoding protein xy)

3. Get a list with all possible guide RNAs you can use

4. Now you can look at their efficiency (and other factors) and choose the one or two guide RNAs you like the most

5. Order your guide RNAs from a biotech company just like you would order a book from amazon

Creating a shuttle

A few days later, your guide RNA arrives in the lab. What now? You somehow need to place your guide RNA in a cell, in the best case together with the endonuclease Cas9. Unfortunately, cells are small and you cannot just squeeze your guide RNA in there, first because RNA is super small even compared to the size of a cell and second because it would quickly be degraded. So you need something like a shuttle to keep it safe. Here is where vector plasmids enter the game.

Plasmids are what keeps doctors up at night. They consist of circular DNA and occur in bacteria, but in contrast to DNA in the nucleus, bacteria do not need plasmids for their survival. They do not contain information about the regular growth or reproduction, but rather additional information that can be beneficial: for example resistances against antibiotics. Bacteria can survive well without these resistances, but they have a great benefit if they are resistant. What makes plasmids cool but also dangerous is that they can get transferred between different bacteria. If one bacterial cell gains an antibiotic resistance (maybe because of a mutation on its plasmid), it can pass on this information to all the bacteria around.

Plasmids are easy to extract from bacteria in the lab, half an hour and you are done. Additionally, they are quite easy to mutate. One to three days (dependent on the techniques you use, find an example here) and you can be done as well. Let’s bring guide RNAs and plasmids together. You can mutate a plasmid in a way that afterwards it contains DNA encoding the Cas9 endonuclease as additional information. In the next step, you mutate it again to contain also the guide RNA. Now you have a circular piece of DNA with Cas9 and a guide RNA. Looks good already, doesn’t it?

Finally: A mutated pig

The problem: Your CRISPR-Cas9 system is still not in the cells, where you want it to be. Dependent on the organism you want to mutate, you need to choose a different method now. For plants you would for example chose a different method than you would for mutating a pig’s heart (find the paper about what they did exactly in case of the pig here). The problem about this pig’s heart is that it is inside of a pig. And it is quite deadly for the pig to just remove for a while to mutate it. What is done instead is a process called microinjection (or at least this is one of the methods you can use). You take a fertilized egg and inject your vector plasmid with a super, super tiny needle. The CRISPR-Cas9 system (consisting of Cas9 and the guide RNA) targets the desired piece of DNA and creates a cut. Protein xy encoded by the DNA cannot be produced anymore. The fertilized egg is put in another pig again and grows into a baby pig. And then you hope for the best.

Does this sound… a bit mean? At least, nobody got the pigs consent beforehand whether it would desire a mutated heart. This is why ethics committees are discussing about CRISPR-Cas9 for around ten years now already. Another point is that you cannot only switch off protein xy. You can basically switch off any protein you want. Does this create a pig with a heavy disease? Maybe, you never know.

Final thoughts

Can you create a ‘super human’? First, it luckily is illegal to experiment on human embryos with CRISPR-Cas9 in most countries. But just talking theoretically, it depends on how you define the term ‘super human’. If you mean a person that is crazy intelligent and super strong, then probably not. This is the case because you still need a defined part of DNA you aim to mutate. On the human DNA, there is no such gene that encodes ‘This human is super intelligent’. Many genes contribute to human intelligence, and also factors like education are of course necessary to considerate. You would have to mutate parts of the human brain to increase chances of getting a super intelligent baby, but we still know so little about the brain this probably would result in a catastrophe — meaning the embryo would die. The situation is different when we are talking about designer babies. This would mean that you could guarantee that a baby has blue eyes and is immune against disease x. Yes, in theory you could do that. Should you do it? This is a different question scientists discussed about for decades and still didn’t come to a final conclusion.

Some thoughts about tomatoes

CRISPR-Cas9 is cool, because you can create super precise mutations in an organism. Think about tomatoes for example. The tomatoes you find in the supermarket today look quite different from what the ‘original’ tomato looked like thousand years ago. But it took years and years of trial and error to cultivate tomatoes until they reached their ‘modern’ size and shape. And because you never knew which tomato in your garden was mutated currently and also not in what way, it was possible that a tomato would be huge and perfectly red, but also toxic. With CRISPR-Cas9, this would probably not happen as you can be sure to mutate only the gene encoding ‘This tomato is perfectly red’ and not accidentally change the gene encoding ‘This tomato is not toxic at all’.

But — in the wrong hands and applied without thinking further, it is a technique that can cause quite a lot of harm. I only ever used CRISPR-Cas9 on plants and there it was a crazily helpful tool. But I am just a biologist and not a philosopher, so I will leave you with your thoughts about the morality of CRISPR-Cas9. Hopefully after reading this article you feel like you are in a better position to judge.

Thanks for reading my first medium article! Do you know any cool applications for CRISPR-Cas9 or did you hear about it for the first time? Please also leave some love and/or feedback if you enjoyed reading about CRISPR-Cas9!

If you are again interested in the paper where the mutation of the pig’s heart is described in more detail — its this one:

Ryczek, N., Hryhorowicz, M., Zeyland, J., Lipiński, D., Słomski, R. (2021). CRISPR/Cas Technology in Pig-to-Human Xenotransplantation Research. International Journal of Molecular Sciences, 22(3196). doi:10.3390/ijms22063196

Here are the two papers which first described the CRISPR-Cas9 technique:

Mali, P., Yang, L., Esvelt, K. M., Aach, J., Guell, M., Dicarlo, J. E., . . . Church, G. M. (2013). RNA-Guided Human Genome Engineering via Cas9. Science, 339(6121), 823–826. doi:10.1126/science.1232033

Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., . . . Zhang, F. (2013). Multiplex Genome Engineering Using CRISPR/Cas Systems. Science, 339(6121), 819–823. doi:10.1126/science.1231143

On the track of discovering the CRISPR-Cas9 system — what viruses have to do with all of it:

Andersson, A. F, & Banfield, J. F. (2008). Virus Population Dynamics and Acquired Virus Resistance in Natural Microbial Communities. Science, 320, 1047–1050. doi: 10.1126/science.1157358

More on Cas9:

Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. (2012). A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 337(6096):816–21. doi: 10.1126/science.1225829

A more detailed description containing a lab protocol:

Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F (2013). Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 8(11):2281–2308. doi: 10.1038/nprot.2013.143

How to mutate any organism with CRISPR-Cas9 was originally published in Biology 4 Everyone on Medium, where people are continuing the conversation by highlighting and responding to this story.